Welcome to the BioOptimizer Web Server

About BioOptimizer

BioOptimizer is an algorithm designed to clean up the motifs found by BioProspector by finding the configuration of motif start sites that maximizes a scoring function based on the log-posterior distribution given in Jensen et al (2004) and Jensen and Liu (2004). In addition, the algorithm allows the motif width to vary and attempts to find the best motif width, again in terms of maximizing the scoring function.

Click here to download a tar file with stand-alone perl scripts of BioOptimizer.

Jensen, S.T. and Liu, J.S. (2004).
BioOptimizer: a Bayesian scoring function approach to motif discovery.
Bioinformatics 20:1557-1564.

Jensen, S.T., Liu, X.S., Zhou, Q. and Liu, J.S. (2004).
Computational discovery of gene regulatory binding motifs: a Bayesian perspective.
Statistical Science 19:188-204.

Please reference the first of these papers when using results from BioOptimizer.

Step 1: Finding Motifs with BioProspector

You can use the program BioProspector to find one or two-block motifs of known width in your sequence dataset either by downloading a stand-alone version or using a web-based version of BioProspector, both of which are found at the BioProspector website (under "Motif-Finding").

For both BioProspector and BioOptimizer, your sequences must be in FASTA format e.g.,

>genename1
acgtacgatcgatcatgactacgatcgactgcat
>genename2
agctagctagctgactagctagctacgtacgatc

Step 2: Inputting Original Sequences

BioOptimizer needs your original sequences, which you should cut and paste into the box below:

Step 3: Inputting Motif Output from BioProspector

BioOptimizer also needs your BioProspector output, which can contain one or more discovered motifs found in same set of sequences. You can just cut and paste the entire BioProspector output file into the box below:

Step 4: Providing Motif Parameters

  1. Please give the number of motifs contained in your BioProspector output:

  2. Are the BioProspector results for a one-block or two-block motif?

  3. BioProspector forced you to input a fixed motif width, but BioOptimizer will let the motif width vary in order to find an optimal width. However, you still must give an expected motif width for each block:
    Block 1 Expected Width:
    Block 2 Expected Width: (leave blank for one-block motifs)

  4. For a two-block motif, BioOptimizer will also try to find the optimal gap between the two blocks, but you must provide the maximum and minimum gap that you used for BioProspector
    Minimum Gap Length: (leave blank for one-block motifs)
    Maximum Gap Length: (leave blank for one-block motifs)

  5. Should the motif sites only be on the forward strand, or should both strands be searched?

Step 5: Providing Email Address and Submitting Job

Your BioOptimizer results will be sent to the email address you provide. You are also required to give a job name that will be used to identify your job on our server. Once you have provided this information, press the submit button (only once!) to submit your job.

Email Address:

Job Name: (no spaces please!)



Note that the program may take some time (5-10 minutes) to run. Please to do not refresh the browser or hit submit more than once!

Additional Notes

1: The "Final BioOptimizer Score" can be used to compare motifs from the same dataset. The motif with the highest (least negative) BioOptimizer score is the best motif.

2: In some cases, BioOptimizer will produce a motif with no sites, even when the input motif has sites. This means that the input motif has a lower score than a motif with no sites, which is an indication that the input motif is quite weak.